Search found 106 matches

by Raiyan Kamal
Tue Mar 29, 2005 5:11 pm
Forum: Volume 4 (400-499)
Topic: 444 - Encoder and Decoder
Replies: 155
Views: 22530

Dear thinker, there are some good posts on this topic in this forum. You can see them. Here are also some sample input for you to try with your code. INPUT: This is a problem from volume four. One is to write an encoder-decoder program here. IS THIS A VALID LINE ? To B or not TO be is the QUESTION. ...
by Raiyan Kamal
Tue Mar 29, 2005 4:41 pm
Forum: Volume 7 (700-799)
Topic: 726 - Decode
Replies: 36
Views: 10006

The memory limit is 32MB. So one can also get Accepted by using a linear array not exceeding 32MB.
by Raiyan Kamal
Mon Mar 28, 2005 6:58 pm
Forum: Volume 7 (700-799)
Topic: 706 - LCD Display
Replies: 221
Views: 36277

You have to consider leading zeroes. If there is one or more leading zeroes, you have to show them in the output
by Raiyan Kamal
Wed Mar 23, 2005 3:38 pm
Forum: Volume 5 (500-599)
Topic: 548 - Tree
Replies: 23
Views: 11013

Can you please explain the procedure you are using ? it is hard to understand from your code. There can be 10000 nodes in a binary tree, so you have to take time saving measures to get rid of TLE. You can also try these test cases : INPUT : 3 2 1 4 5 7 6 3 1 2 5 6 7 4 7 8 11 3 5 16 12 18 8 3 11 7 16...
by Raiyan Kamal
Fri Jan 21, 2005 1:44 pm
Forum: Volume 5 (500-599)
Topic: 514 - Rails
Replies: 79
Views: 25206

you dont have to check for any such improper cases.
by Raiyan Kamal
Sun Jan 02, 2005 6:23 am
Forum: Volume 6 (600-699)
Topic: 612 - DNA Sorting
Replies: 122
Views: 16953

Are you taking care of printing new lines well ? multiple input problems often cause WA for wrong handling or blank lines. For example, two or three blank lines might mean a 'case' separated by two blank lines. so the output should be what ever the problem specification says about 'blank' cases. If ...
by Raiyan Kamal
Sat Jan 01, 2005 3:15 pm
Forum: Volume 6 (600-699)
Topic: 612 - DNA Sorting
Replies: 122
Views: 16953

here is my output for the cases you have given here. AGTC GTTA TTGC AACCACAGTT GAGGGAGGTG AAGCATGTGG ATCATTGGTT GCAAACGTAT GACTAGGGGC ATTCGGGAGT GGTCCCATGT TATTGTGCGG TTGATCGGAG AAAAGGCGTG AAAACGACAT CCGGTGGCGA GGTTAGGACT TATGCTCTAG TTGCTAAGAA GAGAATGAACAGAGCACGCAGAAACTCATGGCTACTTTTTCTCCCTGGCT AAATT...
by Raiyan Kamal
Sat Jan 01, 2005 2:53 pm
Forum: Volume 6 (600-699)
Topic: 614 - Mapping the Route
Replies: 14
Views: 4159

This is strange ! I think the 'problem' is somewhere else. Chek these things : 1. you are supposed to write 'Maze x'. be careful about the spelling. 2. the number x is supposed to increase by one. 3. some blank lines between two consecutive cases. 4. if you are using e-mail to send you solutions, tr...
by Raiyan Kamal
Thu Dec 30, 2004 11:41 am
Forum: Volume 6 (600-699)
Topic: 614 - Mapping the Route
Replies: 14
Views: 4159

how about a case with initial position 1 1 on a 10X10 map and destination is 10 10 and the destination square is blocked ( you cant reach ).
by Raiyan Kamal
Wed Dec 29, 2004 8:26 pm
Forum: Volume 6 (600-699)
Topic: 614 - Mapping the Route
Replies: 14
Views: 4159

Here are some test cases, hope these will help you. INPUT 2 3 1 1 1 3 1 1 0 0 0 0 4 3 3 2 4 3 0 3 0 0 2 0 0 3 0 0 1 0 1 1 1 1 1 1 3 2 2 1 1 2 2 0 3 3 0 3 3 1 1 3 3 0 0 0 0 0 0 0 0 0 10 10 1 1 12 10 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 2 ...
by Raiyan Kamal
Wed Dec 29, 2004 8:13 pm
Forum: Volume 6 (600-699)
Topic: 612 - DNA Sorting
Replies: 122
Views: 16953

are you sure you are taking care of the ' multiple input ' - thing properly ?
by Raiyan Kamal
Sat Dec 18, 2004 3:51 pm
Forum: Volume 105 (10500-10599)
Topic: 10592 - Freedom Fighter
Replies: 17
Views: 9715

Simple DFS or BFS with a little bit of caution for the special cases. That's all.
by Raiyan Kamal
Tue Nov 02, 2004 10:33 am
Forum: Volume 4 (400-499)
Topic: 497 - Strategic Defense Initiative
Replies: 144
Views: 21822

Try these cases :

INPUT

Code: Select all

6

1
2
3
4
5

5
4
3
2
1

1



1
3
4
2
5
6

OUTPUT:

Code: Select all

Max hits: 5
1
2
3
4
5

Max hits: 1
1

Max hits: 1
1

Max hits: 0

Max hits: 0

Max hits: 5
1
3
4
5
6
by Raiyan Kamal
Mon Nov 01, 2004 10:15 am
Forum: Volume 3 (300-399)
Topic: 315 - Network
Replies: 68
Views: 22001

how about this :

Code: Select all

1
0
the output should be

Code: Select all

0
one more case:

Code: Select all

0
0
0
0
output:
(nothing, program is supposed to terminate)
by Raiyan Kamal
Thu Oct 28, 2004 8:53 am
Forum: Volume 101 (10100-10199)
Topic: 10197 - Learning Portuguese
Replies: 45
Views: 15964

to JackBauer,

I used to scanf("%s") the Portugese part then scanf("%c") to get the spaces and then gets() to take the english part. Your algo seems OK to me. Chek the spellings carefully, very carefully. You know what sort of problem is this one. :)

Go to advanced search